Studio for rent in fort lauderdale.

Get a great Fort Lauderdale, FL rental on Apartments.com! Use our search filters to browse all 139 apartments and score your perfect place! Menu. Renter Tools ... Call for Rent. Studio (754) 354-3613. Email. Novo Las Olas. 220 SE 2nd St, Fort Lauderdale, FL 33301. 1 / 50. 3D Tours. Virtual Tour; $2,803 - 2,884. Studio (754) 247-1584.See all 6 studio apartments in 33309, Fort Lauderdale, FL currently available for rent. Each Apartments.com listing has verified information like property rating, floor plan, school and neighborhood data, amenities, expenses, policies and of course, up to date rental rates and availability.3 days ago · 8,821 apartments for rent in Fort Lauderdale, FL. Filter by price, bedrooms and amenities. ... Fort Lauderdale, FL 33301 . Studio - 2 Beds $2,470 - $4,690. Email ... Monthly Rent. $2,345 - $6,200. Bedrooms. Studio - 3 bd. Bathrooms. 1 - 2 ba. Square Feet. 648 - 1,444 sq ft. Welcome to The Edge at Flagler Village The Edge at Flagler Village offers gorgeous apartments are only matched by its incredible amenities, including a pool, clubhouse, fitness center, and recreation room.The largest available Studio apartment unit in Fort Lauderdale, FL is found at Gables Wilton Park in the Middle River Terrace neighborhood and is 850 square feet priced from $2,241. Ora Flagler Village in the Downtown Fort Lauderdale neighborhood has the second largest Studio, which is sized at 764 square feet and currently listed start at $2,426.

HotPads amenity filters and keyword searches allow you to target exactly what you're looking for in the Fort Lauderdale, FL area. We surface the largest ...1,345 rentals. Sort by: Relevance. 2d ago. 8.6. Very good. Quick look. Furnished Studio. 1450 Se 17th St, Fort Lauderdale, FL 33316. Furnished | Air …Best Recording & Rehearsal Studios in Fort Lauderdale, FL - 42nd Street Recording Studios, Spaceman Studios, Track Side Rehearsal Studio, Power Station Recording Studios, Debonaire Recording Studio, Markee Music, Spectrum Recording Studios, DogManic Recording Studios, Studio 1, Gsound Studios.

Apartment for Rent . Studio $2,860. 419 SE 2nd St, Fort Lauderdale, FL 33301 Unit FL4-ID11 . 1 Day Ago. Favorite. Apartment for Rent . ... You found 147 available rentals in Downtown Fort Lauderdale, Fort Lauderdale. Refine your search by using the filter at the top of the page to view 1, 2 or 3+ bedroom units, as well as cheap, pet friendly ...Find your ideal studio condo in Fort Lauderdale. Discover 49 spacious units for rent with modern amenities and a variety of floor plans to fit your lifestyle.

Cheapest Available Fort Lauderdale Apartments for Rent . The cheapest available apartment rental in Fort Lauderdale, FL is a Studio unit found at Cypress Grove in the Cambridge Park neighborhood priced from $948. Northwest Gardens V in the Downtown Fort Lauderdale neighborhood has the second lowest priced unit, which is a …If you're looking for studio apartments in Fort Lauderdale, FL, you can use RentCafe.com to find the ideal place for you. You can filter your search by location, amenities, price, and more. You can also view photos and floor plans and read reviews of different properties.Welcome to TYE Studios, where creativity and professional photography converge under the perfect conditions. Our state-of-the-art photographic studio, located in the heart of the vibrant South Florida region, offers an ideal space for photographers, filmmakers, and creatives seeking the ultimate environment for their visual projects.Get a great Fort Lauderdale, FL rental on Apartments.com! Use our search filters to browse all 38 apartments under $1,000 and score your perfect place! Menu. Renter Tools ... Studio. Dog & Cat Friendly Pool Maintenance on site Business Center Elevator Laundry Facilities Playground (954) 231-3741. Email.Studio. (754) 666-7533. The Oasis by RAM Apartments. 3870 N Andrews Ave. Oakland Park, FL 33309. $949 - 1,364 Studio. 630 Tennis Club Dr. Fort Lauderdale, FL 33311. Condo for Rent.

Search 85 Apartments For Rent with Studio in Fort Lauderdale, Florida. Explore rentals by neighborhoods, schools, local guides and more on Trulia! Page 2

Studio. (754) 704-5811. 1240 NE 13th Ave. 1240 NE 13th Ave. Fort Lauderdale, FL 33304. $1,400 Studio. The Oasis by RAM Apartments. 3870 N Andrews Ave. Oakland Park, FL 33309.

Studio Apartments for Rent in Fort Lauderdale, FL . 373 Rentals Available . Coasterra Apartments . Updated Today. Favorite. 150 SE 3rd Ave, Fort Lauderdale, FL 33301 . Studio $2,478 - $3,270. Email Email Property Call (754) 354-3559. 419 SE 2nd St, Fort Lauderdale, FL 33301 Unit FL4-ID11 . 1 Day Ago.There is a $500 one-time pet fee (non-refundable) for the first pet, and $250 for the second. Pet rent is $30-50 per month based on pet screening results. There is a weight limit of 75 pounds per pet (full maturity). ... Avalon Fort Lauderdale. Studio-3 Beds • 1-2 Baths. 748-1603 Sqft. 10+ Units Available. Request Tour. $2,219+ Camden ...Find your ideal studio apartment in Central Fort Lauderdale, Fort Lauderdale, FL. Discover 424 spacious units for rent with modern amenities and a variety of floor plans to fit your lifestyle. ... You can click on any of these 424 studio apartments for rent in Central Fort Lauderdale to find more information about the neighborhood, schools ...420 SW 27th Ave, Fort Lauderdale, FL 33312. Videos. Virtual Tour. $1,880 - 1,960. Studio. Specials. Dog & Cat Friendly Fitness Center Pool In Unit Washer & Dryer Clubhouse Stainless Steel Appliances Package Service EV Charging. (754) 354-6083. See all 13 studio apartments in 33313, Fort Lauderdale, FL currently available for rent. Each Apartments.com listing has verified information like property rating, floor plan, school and neighborhood data, amenities, expenses, policies and of course, up to date rental rates and availability. Studio-1 bed. 0-1 bath. $800-$900. Tour. Check availability. 5d+ ago. Cheap Edgewood apartment for rent in Fort Lauderdale. Quick look. 700 Northeast 42nd Street - 704Cabessa Pompano LLC #704, Fort Lauderdale, FL 33315.

Studio; 1 ba; 3,762 sqft - Condo for rent. Show more. 14 days ago ... 3233 NE 32nd Ave APT 201, Fort Lauderdale, FL 33308. $2,550/mo. 2 bds; 2 ba; 1,200 sqft - Condo for rent. Show more. 88 days ago. ... Fort Lauderdale Condos for Rent; Pompano Beach Condos for Rent; Plantation Condos for Rent;Bedrooms. Studio - 3 bd. Bathrooms. 1 - 2 ba. Square Feet. 360 - 1,435 sq ft. Welcome to your new home at The District at Flagler Village. Conveniently located in Fort Lauderdale FL, this pet friendly community features a resort style rooftop pool with lounge seating, outdoor grilling area, fitness center with yoga and spin studio, social ...About 25 rental units are located in North Lauderdale, FL, with the average rent currently at $2,282. The average size for a North Lauderdale, FL studio apartment is 1,023 Sqft, but it doesn’t hurt to know that not all studios are the same. If you’re looking for cheap apartments, you can find a great deal for as low as $948.4848 NE 23rd Ave APT 4C, Fort Lauderdale, FL 33308. $2,200/mo. 1 bd. 1 ba. 660 sqft. - Apartment for rent. 5 hours ago Apply with Zillow. 601 SE 5th Ct APT 102, Fort Lauderdale, FL 33301.790 E Broward Blvd, Fort Lauderdale, FL 33301. 1 / 50. Virtual Tour. Call for Rent. Studio. (754) 354-3613. Novo Las Olas. 220 SE 2nd St, Fort Lauderdale, FL 33301.Beautifully update 1 Bedroom Unit - Welcome to Birch House, a charming one-bedroom apartment located in the heart of Ft. Lauderdale, FL. This retro-inspired apartment offers a cozy and comfortable liv. $2,150/mo. 1 bed 1 bath 668 sq ft. 600 N Birch Rd, Fort Lauderdale, FL 33304.

Book a photo studio rental with Color Fusion Studio to access the latest amenities and equipment for your next photo shoot. Give us a call: (954) 800-9080 ABOUT US

Located in Fort Lauderdale, Florida, Harbordale is an energetic neighborhood with easy access to I-95 and the Port Everglades. This convenient location lets residents enjoy a multitude of water activities, visit Harbordale Park and the Historic Stranahan House Museum, or enjoy the bustling nightlife, shopping, and dining scenes on Las Olas ... 300 sqft. - Apartment for rent. 2 days ago. Loading... 912 N Victoria Park Rd, Fort Lauderdale, FL. $1,400+ Studio. 44 days ago. 913 NE 18th Ave #126, Fort Lauderdale, FL 33304. Check availability. 1 of 33. Flow Fort Lauderdale. 301 SW 1st Ave, Fort Lauderdale FL 33301 (954) 932-5441. $1,657. Rent Savings. 88 units available. Studio • 1 bed • 2 bed • 3 bed • 4 bed. In unit laundry, Putting green, Patio / balcony, Hardwood floors, Dishwasher, Pet friendly + more.Oaklyn is a thoughtfully crafted residential community offering luxury studio, 1, & 2-bedroom apartments for rent in Oakland Park, FL. Schedule a tour today! ... Located in the dynamic city of Oakland Park, Florida, five miles from both Fort Lauderdale and Pompano Beach, Oaklyn places residents within easy reach of everything. On weekends, hang ...One simple search of the Apartments.com inventory of over 1 million currently available rentals should be enough to help you find the Fort Lauderdale efficiency apartment of your dreams. You can click on any of these 4 studio apartments for rent in Lauderdale Estates to find more information about the neighborhood, schools, public transit ...Could be lipstick, earrings, whatever." See more reviews for this business. Best Art Space Rentals in Fort Lauderdale, FL - Zero Empty Spaces, Dance and Yoga Studio Fort Lauderdale, Red Dot Studio, Creative Canvas Studios, Broward Dance Academy, Film Locations Miami.

Studio, 1 Bath, 600 sq ft. 3700 Galt Ocean Dr Unit 1002, Fort Lauderdale, FL 33308 (786) 691-0054. Email. $4,000. ... place to find your next Fort Lauderdale condo at Apartments.com. Click on any one of these 57 available condos for rent in Fort Lauderdale to get information about neighborhoods, on-site amenities, services, nearby transit, and ...

5/1 · 3br · Pompano Beach. $4,000. hide. 1 - 120 of 320. Apartments / Housing For Rent near Fort Lauderdale, FL - craigslist.

301 SW 1st Ave. 301 SW 1st Ave, Unit 3104.870 Fort Lauderdale, FL 33301. $2,800 Studio Apartments Available Apr 17. Furnished.Updated yesterday Special Offer. 347 N New River Dr E APT 1106, Fort Lauderdale, FL 33301. $3,500/mo. 1 bd. 1 ba. 820 sqft. - Condo for rent. 16 hours ago. The Rise at Flagler Village | 405 NE 2nd St, Fort Lauderdale, FL.Find apartments for rent under $1,500 in Fort Lauderdale FL on Zillow. Check availability, photos, floor plans, phone number, reviews, map or get in touch with the property manager. Skip main navigation. ... Studio; 1 ba; 425 sqft - Apartment for rent. Show more. 28 minutes ago. 3001 N Federal Hwy, Fort Lauderdale, FL. $1,300+ Studio 3 units.Cheap rent sounded like a square deal to Fort Lauderdale artist Phoenix Niewidok. Her pop art-infused fabric shop Skirtzophrenic occupies a 150-square-foot room that was previously a back office.See all 1,388 apartments for rent near Keiser University - Fort Lauderdale, FL (University). Each Apartments.com listing has verified information like property rating, floor plan, school and neighborhood data, amenities, expenses, policies and of course, up to date rental rates and availability. ... Studio - 2 Beds. Dog & Cat Friendly Fitness ...By Raisa Habersham. April 24, 2024 5:00 AM. Fort Lauderdale City Hall is seen on Monday, April 17, 2023. The building’s basement flooded amid historic rainfall and …Fort Lauderdale; Find your next Apartment Under $800. You found 0 available rentals in Fort Lauderdale, FL. Refine your search by using the filter at the top of the page to view 1, 2 or 3+ bedroom units, as well as cheap, pet-friendly rentals with utilities included and more. Use our customizable guide to narrow down options.See all available apartments for rent at Flow Fort Lauderdale in Fort Lauderdale, FL. Flow Fort Lauderdale has rental units ranging from 354-1417 sq ft starting at $1594.PadMapper has 4,854 condos, houses, and apartments for rent in Fort Lauderdale. Specifically, 169 studio apartments, 1,458 one-bedroom apartments, 1,142 two-bedroom apartments, 819 three-bedroom apartments are currently available for rent.The Queue features brand new studio, one, two and three bedroom apartments for rent near downtown Ft. Lauderdale, Las Olas and the Riverwalk. 954.945.5111 Apply Now + Menu. 817 SE 2ND AVENUE, …Property Address: 5851 N Andrews Ave Ext, Fort Lauderdale, FL 33309. Phone Number: (754) 704-6948. Send Message.

Fort Lauderdale House for Rent. Nice studio available for rent! Furnished! Community pool and Laundry room! One of the best locations in Fort Lauderdale! Close to Las Olas Blvd: shopping centers, restaurants, plazas and more! House for Rent View All Details . Request Tour (786) 661-2942.0 available studio apartments in Westgate, Fort Lauderdale, FL. Filter by price, bedrooms and amenities. High-quality photos, virtual tours, and unit level details included. ... You found 0 available rentals in Westgate, Fort Lauderdale. Refine your search by using the filter at the top of the page to view 1, 2 or 3+ bedroom units, as well as ...Find a loft apartment for rent in Fort Lauderdale, FL. Lofts come in many shapes and sizes, from hard lofts converted from historical warehouses to soft lofts with newer construction and updated amenities. ... open space, tall windows, exposed beams, original hardwood floors, and rustic brickwork. Lofts tend to be larger than studio apartments ...Instagram:https://instagram. kroger pharmacy polkpnc park seat layoutwhat is wrong with the following piece of mrna taccaggatcactttgccacool serial numbers on dollar bills One simple search of the Apartments.com inventory of over 1 million currently available rentals should be enough to help you find the Fort Lauderdale efficiency apartment of your dreams. You can click on any of these 72 studio apartments for rent in Birch Oceanfront to find more information about the neighborhood, schools, public transit ...Fort Lauderdale House for Rent. Nice studio available for rent! Furnished! Community pool and Laundry room! One of the best locations in Fort Lauderdale! Close to Las Olas Blvd: shopping centers, restaurants, plazas and more! House for Rent View All Details . Request Tour (786) 661-2942. subaru eyesight off check enginemassage rub reviews Studio - 2 Beds • Favorite. $2,900 - $4,900 ... Find Corporate Housing for Rent in Fort Lauderdale, FL. View 88 short term rentals and temporary housing in the Fort Lauderdale, FL area. A short-term lease apartment is perfect if you have just moved, have been displaced by a fire or other disaster or relocating and need a fully furnished ...8,821 apartments for rent in Fort Lauderdale, FL. Filter by price, bedrooms and amenities. High-quality photos, virtual tours, and unit level details included. Skip to content. Map. ... Fort Lauderdale, FL 33312 . Studio - 3 Beds $1,574 - $4,543. Email Email Property Call (754) 228-5358. 5422 NE 17th Ter, Fort Lauderdale, FL 33334 . Updated ... kempf's jewelers Matching Rentals near Uptown Fort Lauderdale - Fort Lauderdale, FL Call for Rent. 2 Beds. 4900 NW 10th Avenue ... Cheap Studio Apartments for Rent in Uptown Fort Lauderdale, Fort Lauderdale, FL. Search Nearby Rentals. New Rental Listings Fort Lauderdale New Rentals; About Us ... If you're looking for studio apartments in Fort Lauderdale, FL, you can use RentCafe.com to find the ideal place for you. You can filter your search by location, amenities, price, and more. You can also view photos and floor plans and read reviews of different properties. 150 SE 3rd Ave, Fort Lauderdale, FL 33301. $2,478 - 3,270. Studio. Specials. Dog & Cat Friendly Fitness Center Pool Dishwasher Refrigerator Kitchen In Unit Washer & Dryer Clubhouse. (754) 354-4013.